POST request via requests (python) not returning data -

-

There is one more question about my post. This post should be the same referenced on the stack overflow by using 'request.post' to post multipart form data by Python ', but for some reason I can not work it's website I posted a file I want to do that which is already in FastAffate on this website and using the requests in Python, select the 'SVM' option. It is based on the fact that @NorthCat had given me first, which used to work as a magic: import request import urlib file = {'file' :( open ('bishop / newdenovo2 .txt ',' R ') Read ())} url =' http://www.camp.bicnirrh.res.in/predict/hii.php 'payload = {"algo []": "svm"} Raw = urllib.urlencode (payload) response = session.post (url, files = file, data = payload) print (response.text)

Since it is not working, It was felt that the payload problem was I was playing with Payload, but I can not get it for any of these works. 

  payload = {'S1': straw (data), 'filename': '', 'algo []': 'svm'} # where i just read the file, 'Data' payload = {'SVM': 'SVM'} is not actually in the # header, but I also tried to do it) Payload = {'S1': '', 'Elgo []': 'SVM ',' B1 ':' Submit '}   
 None of these payloads resulted in data.  
 Any help is appreciated. Thanks a lot!   
 
 
 You must set the file post variable name to "userfile", that means  
  file = {'userfile': (open 'Bishop / NewDenovo .2.txt', 'r'). Read ())}   
 Note that  Read ()  is unnecessary, but this file does not succeed in upload. Here are some code that should work for you:  
  import request session = requests. Session () response = session.post ('http://www.camp.bicnirrh.res.in/ (' Fasta.txt ',' text / plain ')}, data = {' algo [] ':' svm ',' Prediction / hii.php ', files = {' userfile ': (' fasta.txt '})   
  response.text  has HTML results Save it in a file and view it in your browser or parse it in some way and remove the result.  
 In this request I have specified the mime type of "text / plain" for the file. Not necessary, but it is not necessary for the documentation And the recipient can help the server.  
 The contents of my  fasta.txt  file are:  
  & gt; 24.6 Jasd2ktut गत्तगत्तगक्सक्सत्तक्सगतगक्सगागक्साकगकत्तागतगगक्सगकक्टग्गग्गग्तैग्गतसगकागैटाआक्टकाअगगत्तगैग्ग्ग्गैक्सगकाकागकगकगगगकगतगतग्गत्तत्तत्तकगतगकगकगकगंगाक्सत्तैक्टग्ग्ग्कत्तगकतगकतातकगक्यासैक्सतगाअगगगगतगक्स्टक्सत्तक्ग्ग्गैगगतगककगगसतगकटगगकतगतकगतसागकट्सगतगतकगतगगतगत्तग्ग्गत्तागतकक्कगकाकगगकगकाकक्सक्टगतक्कत्तगत्तगतततकताग्गागैतगक्सगगगकाॅक्सगगगगगगतगगगगगकगतसागतसागसत्गगक्टक्टतकगतकगगगकताकाकातकगकताकातग्गक्सगत्तकागतगगतगककककगसगगगतगगगकगतकतकआगगकगगसक्टकगत्तक्यागत्तगकैटस्टगकाकक्सगगतगसतगागतकगगगत्तगकतागटाक्कगकगतगतकाGCATAGCGCGGTGAATATGTTCCCGGGTCTTGTACACACCGCCCGTCACGTCATGGGAGCCGGCAACACTTCGAGTCCGTGAGCTAACCCCCCCTTTCGAGGGTGTGGGAGGCAGCGGCCGAGGGTGGGGCTGGTGACTGGGACGAAGTCGTAACAAGGT

Comments

Post a Comment

Popular posts from this blog

ios - Adding an SKSpriteNode to SKScene from a child SKSpriteNode -

-
I have a SKScene where I am adding an SKSpriteNode I have subclassed the SKSpriteNode class to create this node. In the subclass I am defining some SKActions on Sprite. What do I want to do when the end of this phantom ends the SKAction sequence, then I add a new Prayer node to this scene. How is this possible. The following code is mine: The code for the sequence is that I'm running on the Scansprinitode subclass (TEMissileNode): - SKAction * moveDown = [SKAction moveToY: Self.position.y - 20 Duration: 0.2]; SKAction * animation = [SKAction animateWithTextures: textures timePerFrame: time / 7]; SKAction * moveMissileProjectile = [SKAction Moving: Pointoffscreen Term: Time]; SKAction * group = [SKAction group: @ [animation, movement projectile]]; SKAction * Sequence = [SKAction Sequence: @ [Hilldown, Group, [SKAction removalFromParent]]]; [Self run action: sequence]; From the main scene, I call those actions that execute these tasks TEMissileNode * missile = [tmissil...
Read more

Matlab transpose a table vector -

-
An embarrassing simple question seems to be, but how can I move a Matlab table vector? aTableT = aTable '; I tried a standard syntax for the simple interaction of a line vector to a line vector aTable : ATableT = reshape (aTable, 1, Height (aTable)); and aTableT = rot90 (aTable); According to the head, the last time table should work for table, see. However, I get this error code: Error type in using table / permit (line 396) Undefined function 'permute' for the input arguments. Error in rot 90 (line 29) b = magnitude (b, [2 1 3: ndims (a)]); NB: fliplr is not useful either pretty sure I have covered clear angles - any ideas? Thanks! Try changing your table into an array, move it, then back to a table In other words, try doing this: aTableArray = table2array (aTable); ATableT = array 2table (aTableArray. '); I have also read the document for rot90 , and it says that rot90 is definitely working for tables Do, and I find you...
Read more

c# - Textbox not clickable but editable -

-
I have a small form with 10 text boxes, I have set them in the correct tab order. I want them on my tab service I was wondering if there is a way to set the text box so that they can be selected for editing until they are tabbed. That is ... I do not want the end user to edit the text box to click on them, I just want to make them editable through tabu. this should do the trick public partial category poor text box: Text Box {Safe Override Zero WndProc (Ref: Message Message) {if (m.msg == (Int) WM.LBUTTONDOWN) {Return; // mount down events} base.WndProc (ref m); }} Window message enum can be found. How to do this without anherizing: text box : class EatMouseDown: netwindows {safe override zero WndProc (ref message message) {if (m.msg == (int) WM.LBUTTONDOWN) {return; } Base.WandProc (Ref M); }} Safe Override Zero Onload (EventEurge E) {base.OnLoad (e); How to do this without any part: left a clean part, whatever is important, this can be a buggy but it works R...
Read more